NTNU NTNU-Medisin
   


 MAIN

 RESEARCH

 MEMBERS

 PUBLICATIONS

 SERVICES

 COURSES

 CONFERENCES

 EMPLOYMENT

 JOURNALS

 MEETINGS

 CONTACT


 TOOLS
  Single motif
  Composite motif
  Promoter fetcher
  Compo
  genePI
  PriorsEditor

 DATASETS



 LOGIN

 Last Update:
  September 27, 2017




Genomic region fetching



This tool fetches genomic sequences for a user specified list start and stop positions with chromosome.

!! Input format has to have the following composition:
name	version	chrom	start		end		sequence(optional)		(optional)

example:
R08505	hg18	chr1	227636710		227636735		ccctcctgacccgacccagttgccc	0.99

Example file with one feature:  input_file_example.txt 

There must be a tab between the values.
A tab instead of a value is permitted.
Search
Fetch: Genomic sequence Genes in region
Predicted regulatory regions Low Complexity
Left flank
Right flank
Upload file
Export
File Export format Full (tab separated format) ID/sequence (small FASTA format)
Bioinformatics & Gene Regulation
Department of Cancer Research and Molecular Medicine
Norwegian University of Science and Technology
Trondheim, Norway