###########################################################################
# One prediction file should be made corresponding to each dataset file (which can contain several sequences).
# Each line of the prediction file should contain information about one predicted module in that dataset 
# (multiple modules can be predicted within the same sequence but they should then be written on separate lines)
#
# The required information consists of five comma-separated fields
#
# 1) Sequence identifier
# 2) Start position of module
# 3) End position of module
# 4) The module sequence (this is not required and can optionally be replaced with '*') 
# 5) A comma-separated list of predicted single motifs (PWM identifiers)
#    (this field can be dropped if the program does not identify single motifs)  
# 
# Examples:
###########
D13263, 485, 500, atggaaatgtgtcatt, M00172, M00517, M00040, M00174, M00801, M00017, M00981, M00179, M00041, M00408, M00173, M00926, M00338, M00925, M00188
X03020, 509, 529, aacattatttccatcatttcc, M00172, M00517, M00040, M00174, M00801, M00017, M00981, M00179, M00041, M00408, M00173, M00926, M00338, M00925, 
J02288, 811, 824, gcaggaagtgacta, M00172, M00517, M00040, M00174, M00801, M00017, M00981, M00179, M00041, M00408, M00173, M00926, M00338, M00925, M00188
M16567, 439, 462, gaggatgttataaagcatgagtaa, M00172, M00517, M00040, M00174, M00801, M00017, M00981, M00179, M00041, M00408, M00173, M00926, M00338, M00925
X12641, 375, 384, gaaatgaagt, M00172, M00517, M00040, M00174, M00801, M00017, M00981, M00179, M00041, M00408, M00173, M00926, M00338, M00925, M00188, M00514
X12641, 370, 469, aggaggaaatgaagtcatctgtcctctcagcaatcagcatgacagcctccagccaagtaaccctggagtcatgagagctgctaggggagcaacatgaatc, M00172, M00517, M00040, M00174